| Primary Identifier | MGI:7790914 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr589 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Cyp27b1 enhancer, located in a Mettl1 intron, was targeted using sgRNAs (equivalent to GATTAGTTGACCTTTCCTCCTGG and CAGGAACTCCAGACCATGAGAGG) with CRISPR/Cas9 technology, resulting in a 324 bp deletion (GRCm39:chr10:126879179-126879502). This allele was generated in ES cells homozygous for the Rr590em1Pike allele. |
