| Primary Identifier | MGI:7780130 | Allele Type | Endonuclease-mediated |
| Gene | Alas2 | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Alas2 D549Cfs (Alas2 delGA) mice carry a 2 bp deletion in exon 11 of the X-linked mouse Alas2 gene that created a frameshift. This allele was incidentally created during the targeting of Alas2em7Mdf. The 2 bp (CA) deletion (c.1645_1646del; p.D549Cfs) was introduced as part of non-homologous end joining (NHEJ) CRISPR/cas9 processes in C57BL/6NCrl blastocysts (sgRNA: ATGCAGCCACAGACACATCT). |
