| Primary Identifier | MGI:7665220 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(5Rr481-Rr490)3Mam |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The three Csn2 enhancers Rr481, Rr482 and Rr490 were deleted by targeting Rr481in zygotes that carry the Del(5Rr482-Rr490)2Mam allele (containing the deletion of the other two enhancers) using sgRNAs (equivalent to AGATGGTTCACAAACTCAACAGG and AGTGAACCCTAATGTAACAGTGG) with CRISPR/Cas9 technology, resulting in a 1381 bp deletion in addition to the existing 9271 bp Rr482+Rr490 deletion. |
