| Primary Identifier | MGI:7665221 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(5Rr491-Rr490)4Mam |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The three Csn2 enhancers Rr481, Rr482 and Rr490 were deleted, and promoter Rr491 was modified with GRCm39:g.chr5:8784737C>T and 87847422G>A nucleotide mutations in two GAS motifs by targeting the promoter in zygotes that carry the Del(5Rr481-Rr490)3Mam allele (containing the enhancer deletions) using sgRNAs (equivalent to TCAATTCCAAGAAGTCTACGTGA and TTCTTGGGAAAGACAATAGA) and an ssODN template with CRISPR/Cas9 technology. |
