|  Help  |  About  |  Contact Us

Allele : Rr493<em1Andg> regulatory region 493; endonuclease-mediated mutation 1, Guillaume Andrey

Primary Identifier  MGI:7666389 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr493
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  A 1.2-kb region, containing Pitx1 pan-limb enhancer Pen, was deleted using sgRNAs (equivalent to TGTGCTATCTAGGGAAGAAT and CGTGCTATCGAGGGACTAAT) with CRISPR/Cas9 technology, leading to a 45% loss of Pitx1 mRNA expression.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Pitx1<Pen->,
  • Pitx1<Pen>,
  • Pitx1<Pen>,
  • Pitx1<Pen->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories