|  Help  |  About  |  Contact Us

Allele : Rr492<em1Andg> regulatory region 492; endonuclease-mediated mutation 1, Guillaume Andrey

Primary Identifier  MGI:7666513 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr492
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  A section of genomic sequence, containing Pitx1 distal or pituitary gland enhancer PDE or Pit, was deleted using sgRNAs (equivalent to GAAACCGGGAGACGGTGATC and TTCACACCTGTACTCTAGTG) with CRISPR/Cas9 technology.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Pitx1<del2>,
  • Pitx1<del2>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories