|  Help  |  About  |  Contact Us

Allele : In(13Rr494;Rr493)1Andg inversion, Chr 13, Guillaume Andrey 1

Primary Identifier  MGI:7666515 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  In(13Rr494;Rr493)1Andg
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  A section of genomic sequence, containing Pitx1 enhancer RA4, the Macroh2a1 gene and Pitx1 pan-limb enhancer Pen, was inverted using sgRNAs (equivalent to AACAAGATGATACCGCATGG and CGTGCTATCGAGGGACTAAT) with CRISPR/Cas9 technology.
  • mutations:
  • Inversion
  • synonyms:
  • Pitx1<inv1>,
  • Pitx1<inv1>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

1 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories