| Primary Identifier | MGI:7666517 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region, Null/knockout | Gene | Del(13Neudnr-Rr272815)4Andg |
| Transmission | Germline | Strain of Origin | (129S6/SvEvTac x C57BL/6NCrl)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A 50-kb H3K27me3-enriched polycomb-repressed domain surrounding Neurog1 (GRCm39:chr13:56366453-56416452) was deleted using sgRNAs (equivalent to TGACAGCGACATCTAAACTG and GGCAGGAAGAGAGATTCACT) with CRISPR/Cas9 technology. The deletion encompasses predicted lncRNA Neudnr, the Neurog1 gene, predicted CTCF-binding site Rr272815 and other predicted CTCF-binding sites as well as a predicted enhancer. |