|  Help  |  About  |  Contact Us

Allele : Del(13Neudnr-Rr272815)4Andg deletion, Chr 13, Guillaume Andrey 4

Primary Identifier  MGI:7666517 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region, Null/knockout Gene  Del(13Neudnr-Rr272815)4Andg
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  A 50-kb H3K27me3-enriched polycomb-repressed domain surrounding Neurog1 (GRCm39:chr13:56366453-56416452) was deleted using sgRNAs (equivalent to TGACAGCGACATCTAAACTG and GGCAGGAAGAGAGATTCACT) with CRISPR/Cas9 technology. The deletion encompasses predicted lncRNA Neudnr, the Neurog1 gene, predicted CTCF-binding site Rr272815 and other predicted CTCF-binding sites as well as a predicted enhancer.
  • mutations:
  • Intergenic deletion,
  • Intragenic deletion
  • synonyms:
  • Neurog1<del>,
  • Neurog1<del>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

2 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories