| Primary Identifier | MGI:7666518 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region, Null/knockout | Gene | Del(13Gm47071-Rr272802)5Andg |
| Transmission | Germline | Strain of Origin | (129S6/SvEvTac x C57BL/6NCrl)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | To mimic the human Liebenberg syndrome deletion, a 120-kb deletion (GRCm39:chr13:56186453-56306452) was engineered using sgRNAs (equivalent to AACAAGATGATACCGCATGG and ACCCACCAGTACGATCGCTC) with CRISPR/Cas9 technology. The deletion encompasses the 3' end of predicted lncRNA Gm47071, the Macroh2a1 gene, predicted CTCF-binding site Rr272802 and other predicted CTCF-binding sites as well as numerous predicted enhancers. |
