|  Help  |  About  |  Contact Us

Allele : Del(13Gm47071-Rr272802)5Andg deletion, Chr 13, Guillaume Andrey 5

Primary Identifier  MGI:7666518 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region, Null/knockout Gene  Del(13Gm47071-Rr272802)5Andg
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  To mimic the human Liebenberg syndrome deletion, a 120-kb deletion (GRCm39:chr13:56186453-56306452) was engineered using sgRNAs (equivalent to AACAAGATGATACCGCATGG and ACCCACCAGTACGATCGCTC) with CRISPR/Cas9 technology. The deletion encompasses the 3' end of predicted lncRNA Gm47071, the Macroh2a1 gene, predicted CTCF-binding site Rr272802 and other predicted CTCF-binding sites as well as numerous predicted enhancers.
  • mutations:
  • Intragenic deletion,
  • Intergenic deletion
  • synonyms:
  • Pitx1<delL>,
  • Pitx1<delL>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

3 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories