| Primary Identifier | MGI:7703312 | Allele Type | Endonuclease-mediated |
| Attribute String | Recombinase | Gene | Drd1 |
| Strain of Origin | C57BL/6J | Is Recombinase | true |
| Is Wild Type | false |
| molecularNote | A sgRNA (GGTTGAATGCTGTCCGCTGT) was used to insert a viral 2A oligopeptide (P2A) self cleaving peptide, to mediate ribosomal skipping, fused to a flpo recombinase sequence (flpo) at 2901 bp in the dopamine receptor D1 (Drd1) gene, immediately upstream of the stop codon in exon 2. |
