| Primary Identifier | MGI:7703762 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr112507 |
| Transmission | Germline | Strain of Origin | (129S6/SvEvTac x C57BL/6NCrl)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The CTCF-binding site, located in Lmbr1 intron 5, was deleted using an sgRNA with CRISPR/Cas9 technology. This allele represents two different deletions (CTAGTGGCCAA on one copy of chromosome 5 and CTGGAGTCCTCTAGTGGCCAACTGGAGAA on the other) that overlap/contain the binding site AGTCCTCTAGTGGCCAACT. |