|  Help  |  About  |  Contact Us

Allele : Rr112507<em1Andg> regulatory region 112507; endonuclease-mediated mutation 1, Guillaume Andrey

Primary Identifier  MGI:7703762 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr112507
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  The CTCF-binding site, located in Lmbr1 intron 5, was deleted using an sgRNA with CRISPR/Cas9 technology. This allele represents two different deletions (CTAGTGGCCAA on one copy of chromosome 5 and CTGGAGTCCTCTAGTGGCCAACTGGAGAA on the other) that overlap/contain the binding site AGTCCTCTAGTGGCCAACT.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • deltaCTCF i5,
  • deltaCTCF i5
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories