|  Help  |  About  |  Contact Us

Allele : Rr112510<em2Andg> regulatory region 112510; endonuclease-mediated mutation 2, Guillaume Andrey

Primary Identifier  MGI:7703763 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr112510
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  The CTCF-binding site located in Lmbr1 intron 4, was deleted using an sgRNA with CRISPR/Cas9 technology in ESCs that carry the Rr112507em1Andg CTCF-binding site deletion allele. This allele represents two different deletions (CTTCTACTGCCACCTGCTGGTATCAC on one copy of chromosome 5 and CTGGCTCACCATAGAGTTATCTTCTACTGCCACCTGCTGGTATCACAAAATAGTTCAAAATA on the other) that contain the binding site CTGCCACCTGCTGGTATCA.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • deltaCTCF i4,
  • deltaCTCF i4
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories