|  Help  |  About  |  Contact Us

Allele : Rr29<em2Andg> regulatory region 29; endonuclease-mediated mutation 2, Guillaume Andrey

Primary Identifier  MGI:7703771 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr29
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  A CTCF-binding site associated with Shh enhancer ZRS or MFCS1, located in Lmbr1 intron 5, was deleted using an sgRNA with CRISPR/Cas9 technology in ESCs that carry the Rr112510em2Andg and Rr112507em1Andg CTCF-binding site deletion alleles. This allele represents two different deletions (ACCAGTGCTCCCTAGTGGGGG on one copy of chromosome 5 and CTCCCTAGTGGGGGAGAG on the other) that overlap the binding site TGCTCCCTAGTGGGGGAGA.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • deltaCTCF ZRS,
  • deltaCTCF ZRS
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories