| Primary Identifier | MGI:7703771 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr29 |
| Transmission | Germline | Strain of Origin | (129S6/SvEvTac x C57BL/6NCrl)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A CTCF-binding site associated with Shh enhancer ZRS or MFCS1, located in Lmbr1 intron 5, was deleted using an sgRNA with CRISPR/Cas9 technology in ESCs that carry the Rr112510em2Andg and Rr112507em1Andg CTCF-binding site deletion alleles. This allele represents two different deletions (ACCAGTGCTCCCTAGTGGGGG on one copy of chromosome 5 and CTCCCTAGTGGGGGAGAG on the other) that overlap the binding site TGCTCCCTAGTGGGGGAGA. |
