| Primary Identifier | MGI:7781817 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cbr1b |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 4 sgRNAs (equivalent to CCTCATCAAAGGGTTTGCA, AAGGAGATCAGGCCTTAAGC, TTACGGGGTAGGACTCCTT and TATTTGCAGGGTAGGTTACG), resulting in a 2814 bp deletion that includes the proximal promoter and exons 1 and 2 (ENSMUSE00000720738 and ENSMUSE00001039070; GRCm39), leading to the absence of protein. |
