| Primary Identifier | MGI:7781821 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mcm3ap |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 4 sgRNAs (equivalent to CTTAAAATCAAGTGACCACA, GATTTTAAGTCCCACGATCT,TCCTAGCATACCTACGGGGT and CACATCCTAGCATACCTACG), resulting in a 2796 bp deletion that includes exon 3 (ENSMUSE00000131646; GRCm39), leading to a frameshift and premature stop codon. |