| Primary Identifier | MGI:7781824 | Allele Type | Endonuclease-mediated |
| Gene | Ptchd1 | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This allele was generated at the Institut Clinique de la Souris by co-electroporating Cas9 protein, a crRNA (GTTGATTGATTGCAGATAGT)/tracrRNA and an ssODN template, which resulted in a p.Y213C mutation in exon 2 (ENSMUSE00000252591; GRCm39). An NspI diagnostic restriction site was introduced to facilitate genotyping. |