|  Help  |  About  |  Contact Us

Allele : Rr489<em1Mam> regulatory region 489; endonuclease-mediated mutation 1, Lothar Hennighausen

Primary Identifier  MGI:7664585 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr489
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  The enhancer, part of casein gene cluster super-enhancer Rr485, was deleted using an sgRNA (equivalent to TGGGTGTTCTTCCACTAGACAGG) with CRISPR/Cas9 technology, resulting in an 871 bp deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • SE-deltaE4,
  • SE-deltaE4
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories