| Primary Identifier | MGI:7666638 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region, Reporter | Gene | Rr493 |
| Transmission | Germline | Strain of Origin | (129S6/SvEvTac x C57BL/6NCrl)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A DNA construct containing 50-bp of the beta-globin gene promoter upstream of the beta-galactosidase gene lacZ was inserted at GRCm39:chr13:56303701 next to Pitx1 pan-limb enhancer Pen using an sgRNA (equivalent to GAGAACAATGAGCGCATTGC) with CRISPR/Cas9 technology. |