| Primary Identifier | MGI:7703298 | Allele Type | Endonuclease-mediated |
| Attribute String | No functional change | Gene | Aqp4 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR/cas9 endonuclease-mediated genome editing. A guide RNA (ATTGTCTTCCGTATGACTAG) was used to insert two additional stop codon sequences in the frame downstream of the canonical stop codon in the aquaporin 4 (Aqp4) gene. Additional stop codons prevent unusual stop codon readthrough events generating a conserved C-terminally elongated variant of Aquaporin 4 (AQP4X). |
