|  Help  |  About  |  Contact Us

Allele : Aqp4<em2Jdd> aquaporin 4; endonuclease-mediated mutation 2, Joseph D Dougherty

Primary Identifier  MGI:7703300 Allele Type  Endonuclease-mediated
Attribute String  Modified isoform(s) Gene  Aqp4
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using CRISPR/cas9 endonuclease-mediated genome editing, a guide RNA (ATTGTCTTCCGTATGACTAG) was used to insert a TGA-to-TGG mutation, resulting in a stop codon to sense codon, in the aquaporin 4 (Aqp4) gene. Conversion of canonical stop codons to a sense codon results in stop codon readthrough events generating a conserved C-terminally elongated variant of Aquaporin 4 (AQP4X).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • AllX,
  • AllX
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories