| Primary Identifier | MGI:7703300 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified isoform(s) | Gene | Aqp4 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR/cas9 endonuclease-mediated genome editing, a guide RNA (ATTGTCTTCCGTATGACTAG) was used to insert a TGA-to-TGG mutation, resulting in a stop codon to sense codon, in the aquaporin 4 (Aqp4) gene. Conversion of canonical stop codons to a sense codon results in stop codon readthrough events generating a conserved C-terminally elongated variant of Aquaporin 4 (AQP4X). |
