| Primary Identifier | MGI:7703479 | Allele Type | Endonuclease-mediated |
| Attribute String | Reporter | Gene | Rr496 |
| Transmission | Germline | Strain of Origin | (129S6/SvEvTac x C57BL/6NCrl)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A DNA construct containing 50-bp of the beta-globin gene promoter upstream of the EGFP green fluorescent reporter gene was inserted upstream of the Pitx1 promoter using an sgRNA (targeting GAAACCGGGAGACGGTGATC GRCm39:chr13:55981823-55981842) with CRISPR/Cas9 technology. The reporter recapitulates Pitx1 expression. |