|  Help  |  About  |  Contact Us

Allele : Fap<em1(cre/ERT2)Nros> fibroblast activation protein; endonuclease-mediated mutation 1, Nadia Rosenthal

Primary Identifier  MGI:7781802 Allele Type  Endonuclease-mediated
Attribute String  Inducible, Recombinase Gene  Fap
Strain of Origin  C57BL/6J Induced With  tamoxifen
Is Recombinase  true Is Wild Type  false
molecularNote  A Cre-ERT2-bGHpA cassette was introduced to the start codon in exon 1 of the mouse Fap gene using CRISPR/SpCas9 methodologies (gRNAs: AAAAACATCTGGAAAAATGA and AAGGTTAGTGCGTGCCGTCT) in C57BL/6J embryos.
  • mutations:
  • Insertion
  • synonyms:
  • FAP<creERT2>,
  • FAP<creERT2>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

1 Driven By

3 Publication categories