|  Help  |  About  |  Contact Us

Allele : Prune1<em1(IMPC)Ics> prune exopolyphosphatase; endonuclease-mediated mutation 1, Mouse Clinical Institute

Primary Identifier  MGI:7781825 Allele Type  Endonuclease-mediated
Gene  Prune1 Strain of Origin  C57BL/6N
Is Recombinase  false Is Wild Type  false
molecularNote  This allele was generated at the Institut Clinique de la Souris by co-electroporating Cas9 protein, a crRNA (CTTACTTGGGTAAAATATGG)/tracrRNA and an ssODN template, which resulted in a p.D106N mutation in exon 3 (ENSMUSE00000253496; GRCm39). A DdeI diagnostic restriction site was introduced to facilitate genotyping.
  • mutations:
  • Nucleotide substitutions
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories