|  Help  |  About  |  Contact Us

Allele : Rr480<em1Mam> regulatory region 480; endonuclease-mediated mutation 1, Lothar Hennighausen

Primary Identifier  MGI:7664590 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr480
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  The proximal Csn1s1 enhancer was deleted using sgRNAs (equivalent to TGAAAGGATGGCACTCTCTGCGG and TTTGCCATGATCTGACTACGTGG) with CRISPR/Cas9 technology, resulting in a 181 bp deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Csn1s1-deltaE2,
  • Csn1s1-deltaE2
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories