|  Help  |  About  |  Contact Us

Allele : Rr481<em1Mam> regulatory region 481; endonuclease-mediated mutation 1, Lothar Hennighausen

Primary Identifier  MGI:7664591 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr481
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  The distal Csn2 enhancer was deleted using sgRNAs (equivalent to AGATGGTTCACAAACTCAACAGG and AGTGAACCCTAATGTAACAGTGG) with CRISPR/Cas9 technology, resulting in a 1381 bp deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Csn2-deltaE1,
  • Csn2-deltaE1
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories