|  Help  |  About  |  Contact Us

Allele : Rr484<em1Mam> regulatory region 484; endonuclease-mediated mutation 1, Lothar Hennighausen

Primary Identifier  MGI:7664593 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr484
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  The proximal Csn3 enhancer was deleted using sgRNAs (equivalent to CAGGTCATCCTATTGCCTCAAGG and GTGTAATGGTTCCCAGAAACAGG) with CRISPR/Cas9 technology, resulting in a 194 bp deletion. The deletion includes the GAS and GR motifs but not the NFIB motifs.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Csn3-deltaE2-S,
  • Csn3-deltaE2-S
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories