| Primary Identifier | MGI:7664594 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr484 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The proximal Csn2 enhancer was deleted using sgRNAs (equivalent to CAGGTCATCCTATTGCCTCAAGG and GTGTAATGGTTCCCAGAAACAGG) with CRISPR/Cas9 technology, resulting in a 1071 bp deletion. The deletion includes the GAS, GR and NFIB motifs. |