| Primary Identifier | MGI:7664605 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr491 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Csn2 promoter was modified with GRCm39:g.chr5:8784737C>T and 87847422G>A nucleotide mutations in two GAS motifs using sgRNAs (equivalent to TCAATTCCAAGAAGTCTACGTGA and TTCTTGGGAAAGACAATAGA) and an ssODN template with CRISPR/Cas9 technology. |
