| Primary Identifier | MGI:7666143 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cwc25 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCAGGCAGCCGTTCCCATGT and AATACTTCTCACAATCCATG. This resulted in a 1,923 bp deletion of Chr11:97,756,111-97,758,033 (GRCm38/mm10) that removed exons ENSMUSE00000111149 and ENSMUSE00000111153. |