| Primary Identifier | MGI:7703518 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr493 |
| Transmission | Germline | Strain of Origin | (129S6/SvEvTac x C57BL/6NCrl)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A 1.2-kb region, containing Pitx1 pan-limb enhancer Pen, was deleted using sgRNAs (equivalent to GCCTAGTGGAGGCGCGGCTT and CGTGCTATCGAGGGACTAAT) with CRISPR/Cas9 technology using ES cells that contain the Rr496em2Andg allele. |