| Primary Identifier | MGI:7787086 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mmp1b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGGGTAGAGGGGACCTGTGA and TTAGAAAATACTGCAGTCCC. This resulted in a 1,598 bp deletion of Chr9:7,386,141-7,387,738 (GRCm38/mm10) that removes exon ENSMUSE00000302943, ENSMUSE00000983617 and ENSMUSE00000302891. |
