| Help | About | Contact Us

Allele : Ccdc93<em1Sgan> coiled-coil domain containing 93; endonuclease-mediated mutation 1, Santhi K Ganesh

Primary Identifier	MGI:7751862	Allele Type	Endonuclease-mediated
Attribute String	Null/knockout	Gene	Ccdc93
Strain of Origin	(C57BL/6 x SJL)F1	Is Recombinase	false
Is Wild Type	false

molecularNote

Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (GGCGAAAGTACCGACGGCAG) was used to generate a 21-nucleotide deletion in a region spanning intron 6/exon 7 (2 nucleotides in intron 6 and 19 nucleotides in exon 7) of the coiled-coil domain containing 93 (Ccdc93) gene on chromosome 1.

mutations:
Intragenic deletion

synonyms:
Ccdc93<->,
Ccdc93<->

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

1 Carried By

0 Driven By

2 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76883693

MouseMine