| Primary Identifier | MGI:7750855 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Defb23 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GACCACCTTAGACATGCCCA and CTGAGTGGTAGAAAAGCCCG. This resulted in a 5,473 bp deletion of Chr2:152,301,060-152,306,532 (GRCm38/mm10) that removes exons ENSMUSE00000640004 and ENSMUSE00000640003. |
