|  Help  |  About  |  Contact Us

Allele : Rr574<em1Ddu> regulatory region 574; endonuclease-mediated mutation 1, Denis Duboule

Primary Identifier  MGI:7785481 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr574
Is Recombinase  false Is Wild Type  false
molecularNote  Putative Hoxd enhancer Rr574, located between Atp5mc3 and Lnpk, was targeted with sgRNAs (equivalent to TAGAATCATTGGTAGTACGG and TGGTTCTAAGATTTCCGTAA) using CRISPR/Cas9 technology, resulting in a 39,050 bp deletion (GRCm39:chr2:74014194-74053243).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Del(IIIE),
  • Del(IIIE)
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele