|  Help  |  About  |  Contact Us

Allele : Rr50361<em2Ddu> regulatory region 50361; endonuclease-mediated mutation 2, Denis Duboule

Primary Identifier  MGI:7785498 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr50361
Is Recombinase  false Is Wild Type  false
molecularNote  Putative Hoxd enhancer Rr50361, located between Atp5mc3 and Lnpk, was targeted with sgRNAs (equivalent to TCAAATCGTACAGCGCTGCC and CACGGGGTGGAGTTATCTAC) using CRISPR/Cas9 technology, resulting in a 14,284 bp inversion (GRCm39:chr2:74122565-74136848).
  • mutations:
  • Inversion
  • synonyms:
  • Inv(V),
  • Inv(V)
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories