|  Help  |  About  |  Contact Us

Allele : 2300009A05Rik<em1(IMPC)J> RIKEN cDNA 2300009A05 gene; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7763954 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  2300009A05Rik
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CAATGCACACTTTCAATACA and CTCCGCAGGGCCTCCATGGC. This resulted in a 4,723 bp deletion of Chr9:63,394,545-63,399,267(GRCm38/mm10) that removes exons ENSMUSE00000891268 and ENSMUSE00001014548.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories