| Primary Identifier | MGI:7789056 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Svs3b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CTTTTCTGGGTGCAGAAAGG and CATACACCACCTAGAAATAC. This resulted in a 1,171 bp deletion of Chr2:164,255,520-164,256,690 (GRCm38/mm10) that removes exon ENSMUSE00000998160 and/through ENSMUSE00001082815. |
