|  Help  |  About  |  Contact Us

Allele : Rr587<em3Mam> regulatory region 587; endonuclease-mediated mutation 3, Lothar Hennighausen

Primary Identifier  MGI:7790524 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr587
Strain of Origin  (C57BL/6J x DBA/2J)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  Klotho enhancer E1, located upstream, was targeted using an sgRNA (equivalent to CTTCTTTCAGTGTGTCGCTTAAA) with CRISPR/Cas9 technology, resulting in a 145 bp deletion (GRCm39:chr5:150836248-150836392) that leads to a reduction in Klotho expression.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • E1 145 bp del,
  • E1 145 bp del
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories