| Primary Identifier | MGI:7790524 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr587 |
| Strain of Origin | (C57BL/6J x DBA/2J)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Klotho enhancer E1, located upstream, was targeted using an sgRNA (equivalent to CTTCTTTCAGTGTGTCGCTTAAA) with CRISPR/Cas9 technology, resulting in a 145 bp deletion (GRCm39:chr5:150836248-150836392) that leads to a reduction in Klotho expression. |