| Primary Identifier | MGI:7763937 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Acrv1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TAACTCCTTCATTTTGATTT and CTTCTTGCTCTGACTTAGGC. This resulted in a 5,361 bp deletion of Chr9:36,693,302-36,698,662 (GRCm38/mm10) that removes exon ENSMUSE00000216596 through ENSMUSE00000395690. |
