|  Help  |  About  |  Contact Us

Allele : Crlf2<em1.1Ics> cytokine receptor-like factor 2; endonuclease-mediated mutation 1.1, Mouse Clinical Institute

Primary Identifier  MGI:7768074 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Crlf2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (equivalent to TTTTAAACGCCTGAAAGAGT) with CRISPR/Cas9 technology, a loxP site and an FRT site flanked neomycin resistance gene cassette were inserted into intron 2 and a second loxP site into intron 3. The neo cassette was removed through subsequent Cre-mediated recombination, leaving a conditional-ready allele with exon 3 floxed.
  • mutations:
  • Insertion
  • synonyms:
  • Crlf2<L2>,
  • Crlf2<L2>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories