| Primary Identifier | MGI:7768074 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready | Gene | Crlf2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (equivalent to TTTTAAACGCCTGAAAGAGT) with CRISPR/Cas9 technology, a loxP site and an FRT site flanked neomycin resistance gene cassette were inserted into intron 2 and a second loxP site into intron 3. The neo cassette was removed through subsequent Cre-mediated recombination, leaving a conditional-ready allele with exon 3 floxed. |
