|  Help  |  About  |  Contact Us

Allele : Polg<em1Murr> polymerase (DNA directed), gamma; endonuclease-mediated mutation 1, Stephen Murray

Primary Identifier  MGI:7768132 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Polg
Strain of Origin  C57BL/6NJ Is Recombinase  false
Is Wild Type  false
molecularNote  Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (RNAs (GTGGGAGGCGAATAGTAAAG and CTGTCTTCCCTAAAGACCGC) were selected to insert /loxP sites flanking exon 3 of the Polg gene..
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories