|  Help  |  About  |  Contact Us

Allele : 2510039O18Rik<em1(IMPC)J> RIKEN cDNA 2510039O18 gene; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7768064 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  2510039O18Rik
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTTGGGCGGCGGGCCCGATG and GTGGCCGAGAGCAGGACTCG. This resulted in a 5,722 bp deletion of Chr4:147,940,909-147,946,630 (GRCm38/mm10) that removes exons ENSMUSE00000334978, ENSMUSE00000661657 and ENSMUSE00000661656.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories