| Primary Identifier | MGI:7797303 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Null/knockout | Gene | Pqbp1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Tryptophan codon 215 (TGG) in exon 5 was changed to a stop codon (TGA) (NM_001252528.1:c.645G>A:p.W215*) using an sgRNA (equivalent to CTCTTGTCCCCAGGGGCACA) and an ssODN template (CTCCACCCTCTTCCTGTACTCTAATTCTCTCTTGTCCCCAGGGGCACATGATCAACAGGACTCCCCAAGAGGAACGAGGCCAAGACAGGT) with CRISPR/Cas9 technology, creating a stop codon in the last exon 49 codons upstream of the endogenous stop codon. This mutation is the equivalent of the human p.W217* mutation found in some Chinese Han children with severe intellectual disability. |
