|  Help  |  About  |  Contact Us

Allele : Pqbp1<em1Jhhan> polyglutamine binding protein 1; endonuclease-mediated mutation 1, Junhai Han

Primary Identifier  MGI:7797303 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence, Null/knockout Gene  Pqbp1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Tryptophan codon 215 (TGG) in exon 5 was changed to a stop codon (TGA) (NM_001252528.1:c.645G>A:p.W215*) using an sgRNA (equivalent to CTCTTGTCCCCAGGGGCACA) and an ssODN template (CTCCACCCTCTTCCTGTACTCTAATTCTCTCTTGTCCCCAGGGGCACATGATCAACAGGACTCCCCAAGAGGAACGAGGCCAAGACAGGT) with CRISPR/Cas9 technology, creating a stop codon in the last exon 49 codons upstream of the endogenous stop codon. This mutation is the equivalent of the human p.W217* mutation found in some Chinese Han children with severe intellectual disability.
  • mutations:
  • Single point mutation
  • synonyms:
  • Pqbp1<W215X>,
  • Pqbp1<W215X>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele