| Primary Identifier | MGI:7797729 | Allele Type | Endonuclease-mediated |
| Gene | Pole | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Using CRISPR technology, a sgRNA (AGGGAATTTGAGAGGCAGTT) was designed to target the Pole gene to introduce 2 mutations: a GAC to GCC resulting in an aspartic acid to alanine mutation at amino acid 272 (D272A) and a GAG to GCG mutation resulting in a glutamic acid to alanine mutation at amino acid 274 (E274A). |
