|  Help  |  About  |  Contact Us

Allele : Pole<em1Ewht> polymerase (DNA directed), epsilon; endonuclease-mediated mutation 1, Eileen White

Primary Identifier  MGI:7797729 Allele Type  Endonuclease-mediated
Gene  Pole Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Using CRISPR technology, a sgRNA (AGGGAATTTGAGAGGCAGTT) was designed to target the Pole gene to introduce 2 mutations: a GAC to GCC resulting in an aspartic acid to alanine mutation at amino acid 272 (D272A) and a GAG to GCG mutation resulting in a glutamic acid to alanine mutation at amino acid 274 (E274A).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Pole D272A E274A,
  • Pole D272A E274A
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele